A sequence analysis of the cytochrome-B locus of the mitochondrial genome of the SA Wild Cat was kindly performed  by Dr **** ****** of the ***** Zoo in Sydney. Please note that Dr ****** is in NO WAY ASSOCIATED with the activities, hypotheses or opinions expressed within this web site. For readers'  information, the exact sequence determined was :-

CTTCGGCTCCCTTCTAGGAGTCTGCCTAATCTTACAAATCCTCA
CCGGCCTCTTTTTGGCCATACACTACACATCAGACACAATAAC
CGCCTTTTCATCAGTTACCCACATCTGTCGCGACGTTAATTATG
GCTGAATCATCCGATATTTACACGCCAACGGAGCTTCTATATTC
TTTATCTGCCTGTACATACATGTGGGACGGGGAATATACTACGG
CTCCACACCTTCTCAGAGACATGAAACATTGGAATCATACTAT
TATTTACAGTCATAGCCACAGCTTTTATGGGATA

Dr *******  found that the sequence clusters with Felis catus and thus the maternal lineage of this animal is of a common domestic cat.

We, of course, also took the above sequence and BLAST compared it against the DNA databases at Entrez - it is indeed a portion of the gene for cytochrome B encoded on the mitochondrial genome of the domestic cat (Felis catus).

The original sequence has one base missing compared to the publicly held sequence. There are a number of different domestic cat sequences in the database and they exhibit a small number of variations among themselves. It's quite likely that these differences are single nucleotide polymorphisms (SNPs) that represent the variation one expects to find within individuals of a species.

Previously we sent a sample of fur from this animal to Dr Lars Thomas of the Royal Copenhagen Museum. Dr Thomas' examination of the fur led him to the conclusion that the owner was merely a feral (domestic) cat. Please note that Dr Thomas is in NO WAY ASSOCIATED with the activities, hypotheses or opinions expressed within this web site.

These results would, on the face of things, appear to settle the question.

Opposing Views "from the Field"
However, the fellow who trapped the animal absolutely insists that these cats grow to a body length, that is from base of tail to neck, of around 4 to 5 feet  and leave tracks of  around 3 inches to 4 inches across the toes. He insists, on the basis of its teeth and some other diagnostic features, that the dead one is only a kitten. He says that the mother cat still lurks nearby. A 4-foot long body versus, say, an 18 inch body for your common or garden "moggie" is big difference I think all would agree.

IF the fellow in South Australia is right, and please bear in mind we're NOT necessarily saying he is, then you're talking about a distinctive population of very large cats  that, at a fundamental level, are identical with Felis catus.

The plaster casts of tracks which we've seen do seem to form a statistically coherent group. That is to say, they cluster around 4" diameter and there's no apparent continuous gradation in size from approximately 0.75" (domestic cat) up to 4" for the  "mystery cat". There's also the Lithgow video tape to consider, the one that was shown on GTV9 earlier this year. If it's genuine, and there doesn't appear to be any particular reason to doubt it, then it shows a very large animal that, apart from its size, looks "just like" a black domestic cat.

What's Going On "Out There"?
In order to leave no stone unturned we are now endeavoring to have the chromosomes from the body cells of this animal examined for the presence of "chromosomal inversions".

We are wondering if it's possible that a speciation event has taken place comparatively recently among Australia's feral cat population? By "comparatively recently" we mean, of course, at  some time during the 20th century or perhaps in the late 19th century.

Given the apparent widespread occurrence of these very large cats, one might be tempted to ask if, possibly, we are seeing an example of sympatric divergence? Such a phenomenon would contradict one well known theoretical model of the mechanism of speciation, due to Mayr, namely allopatric divergence,  as the only way that genetic isolation and speciation can occur. Since the phenomenon is Australia wide, the divergent population - IF it exists, that is (!) -  is plainly not small and thus argues against Mayr's so-called peripheral isolates model.

It's a well known fact of genetics that chromosomal inversion leads to selection against the production of heterozygotes. The difficulty, from the point of view of establishing a genetic divergence, is that the animal with the chromosome inversion will itself be selected strongly against in a broader population of heterozygotes. If divergence is to be "locked in" it has to involve breeding with similar homozygotes which are, by definition, rare. Consequently, the fixation of a chromosomal inversion can only take place where inbreeding can occur. In a small population of peripheral isolates in other words.

Consequently we wonder if one member of a small pocket of our feral cat population had a chromosomal inversion occur and if related animals, possibly sibs from the one litter, have inbred and fixed the change within the group. Perhaps the "inverted" group has then found itself unable to breed successfully with outsiders and, in the face of pressure from foxes, there has been powerful natural selection for increased body size. So Mayr's model might, in this case, prove workable?

We have evidence that Outback foxes do persecute feral cats. Foxes work cooperatively in a pack and, in places where there are few trees to escape into, such as the desert, the solitary cat is plainly in serious danger. But it's obvious to any casual observer that feral cats are in no danger of extinction in the Outback. However, this may be because there is a continuous influx of new arrivals from farm and town. In cases where small populations of  felines have been isolated for some reason, we think that foxes could provide a very powerful selective force favouring increased size & strength.

Where to  next?
To prove the idea one will clearly need physical evidence. The tests done so far - on fur and the cytochrome B gene - would probably not show any discernible differences in a very recently diverged population. A close look at the chromosomes would be a good place to start. A few extra animal specimens, particularly of undisputed adults, would also be useful.

Research into the question of the exact nature and species classification of these mystery cats continues but no firm conclusions are possible as of this date.

More Contradictions!
Opposing what we thought we knew about foxes attacking cats in the about, another fellow, who is in a position to know, says the idea is all rubbish. He says foxes do not persecute feral cats in any way. So ... who knows? Thought we were onto something here. Of course, the cat we've got may have nothing whatever to do with the "big cat" phenomenon. It's all too ambiguous to say anything. So far, anyway.

REFS :

1/ The Quest for Thylacoleo web site : http://www.thylacoleo.com
2/ Dr **** ***** c/o ****** Zoo & ****
     EMAIL :  **********
3/ Dr Lars Thomas, Royal Copenhagen Museum
     EMAIL : lars.thomas@koebenhavn.mail.telia.com
4/  For a general introduction to the ideas of evolution, natural selection and species  formation, try :-
     Evolution, ed. Mark Ridley, Oxford Readers 1997
     The Problems of Evolution, Mark Ridley, Oxford University Press 1983